Circulating Tumor DNA Using Tagged Targeted Deep Sequencing to Assess Minimal Residual Disease in Breast Cancer Patients Undergoing Neoadjuvant Chemotherapy.

Circulating Tumor DNA Using Tagged Targeted Deep Sequencing to Assess Minimal Residual Disease in Breast Cancer Patients Undergoing Neoadjuvant Chemotherapy.

In breast cancer patients undergoing neoadjuvant chemotherapy before surgery, there is an unmet need for non-invasive biomarkers predictive of response. Analysis of DNA circulating tumor (ctDNA) in particular has been the object of several reports, but some of them have studied the application of targeted sequencing marked in (tTDS) for clinical practice and performance compared to digital droplet PCR (ddPCR). Here, we present the first results of an ongoing study involving prospectively accrued, monocentric cohort patients with invasive breast cancer, underwent neoadjuvant chemotherapy followed by surgery with curative intent as per clinical practice.

A pretreatment tumor biopsies and plasma samples were collected before and during treatment, after surgery, and every six months thereafter or until relapse, whichever comes first. pretreatment biopsies were sequenced with 409-gene panel large parallel sequencing (MPS), which enable the identification of mutations in the target and their research in plasma by tTDS and ddPCR as complementary approaches. Using tTDS, we showed the presence of at least one deleterious mutations in all cases of relapse we study (n = 4), with an average lead time of six months before clinical relapse. Association with ddPCR is suboptimal, and only one patient relapse can be identified by the method. tTDS shows potential as a non-invasive method for the early detection of MRD in patients with SM.

Next-generation sequencing (NGS) an interesting alternative approach to PCR-based characterization of plant genetic engineering for security assessment and labeling since NGS is highly sensitive in detecting insertion of T-DNA and vector backbone sequences in transgenic plants. In this study, two transgenic lines independent male Populus tremula, T193-2 and T195-1, both of which carry the gene FLOWERING LOCUS T of Arabidopsis thaliana under the control of the heat-inducible promoter (pHSP :: AtFT) and non-transgenic control W52 clone, which is further characterized by NGS and third generation sequencing.

Circulating Tumor DNA Using Tagged Targeted Deep Sequencing to Assess Minimal Residual Disease in Breast Cancer Patients Undergoing Neoadjuvant Chemotherapy.
Circulating Tumor DNA Using Tagged Targeted Deep Sequencing to Assess Minimal Residual Disease in Breast Cancer Patients Undergoing Neoadjuvant Chemotherapy.

The results support previous findings that T-DNA hemizygously included in the genomic loci of each line. However, T-DNA insertion consists of a conglomeration of one or two copies of the T-DNA together with T-DNA fragments smaller without AtFT section. Based on data from NGS, no extra pieces of T-DNA or vector backbone sequences can be identified in the genome of two transgenic lines. Therefore, the seeds derived from a cross between pHSP :: AtFT elderly male and female transgenic wild plants are expected T-DNA vector backbone fragment or free. Thus, PCR analysis of strengthening the T-DNA fragment with a primer AtFT partial specific enough to determine whether or not the transgenic seeds.

WDR61 Antibody

42853-100ul 100ul
EUR 252.00


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21093 50 ul
EUR 363.00
Description: Mouse polyclonal to WDR61


YF-PA21094 50 ug
EUR 363.00
Description: Mouse polyclonal to WDR61


YF-PA21095 100 ug
EUR 403.00
Description: Rabbit polyclonal to WDR61


YF-PA26652 50 ul
EUR 334.00
Description: Mouse polyclonal to WDR61

WDR61 Conjugated Antibody

C42853 100ul
EUR 397.00

WDR61 Polyclonal Antibody

A61770 100 µg
EUR 570.55
Description: Ask the seller for details

WDR61 cloning plasmid

CSB-CL872416HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: atgaccaaccagtacggtattctcttcaaacaagagcaagcccatgatgatgccatttggtcagttgcttgggggacaaacaagaaggaaaactctgagacagtggtcacaggctccctagatgacctggtgaaggtctggaaatggcgtgatgagaggctggacctacagtggag
  • Show more
Description: A cloning plasmid for the WDR61 gene.

Anti-WDR61 antibody

PAab09500 100 ug
EUR 386.00

pENTR223-WDR61 vector

PVT11997 2 ug
EUR 308.00

anti- WDR61 antibody

FNab09500 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IP: 1:500-1:5000
  • IF: 1:10-1:100
  • Immunogen: WD repeat domain 61
  • Uniprot ID: Q9GZS3
  • Gene ID: 80349
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against WDR61

WDR61 Rabbit pAb

A15520-100ul 100 ul
EUR 308.00

WDR61 Rabbit pAb

A15520-200ul 200 ul
EUR 459.00

WDR61 Rabbit pAb

A15520-20ul 20 ul
EUR 183.00

WDR61 Rabbit pAb

A15520-50ul 50 ul
EUR 223.00

Polyclonal WDR61 Antibody

APR06896G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WDR61 . This antibody is tested and proven to work in the following applications:

Anti-WDR61 antibody

STJ117715 100 µl
EUR 277.00

WDR61 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against WDR61. Recognizes WDR61 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

WDR61 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against WDR61. Recognizes WDR61 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

WDR61 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against WDR61. Recognizes WDR61 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse WDR61 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat WDR61 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human WDR61 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF004283 96 Tests
EUR 689.00

WDR61 Recombinant Protein (Mouse)

RP185357 100 ug Ask for price

WDR61 Recombinant Protein (Mouse)

RP185360 100 ug Ask for price

WDR61 Recombinant Protein (Mouse)

RP185363 100 ug Ask for price

WDR61 Recombinant Protein (Rat)

RP237296 100 ug Ask for price

WDR61 Recombinant Protein (Human)

RP034696 100 ug Ask for price

Anti-WDR61 (3E5-1A12)

YF-MA11680 100 ug
EUR 363.00
Description: Mouse monoclonal to WDR61

WDR61 Polyclonal Antibody, Biotin Conjugated

A61771 100 µg
EUR 570.55
Description: The best epigenetics products

WDR61 Polyclonal Antibody, FITC Conjugated

A61772 100 µg
EUR 570.55
Description: kits suitable for this type of research

WDR61 Polyclonal Antibody, HRP Conjugated

A61773 100 µg
EUR 570.55
Description: fast delivery possible

Wdr61 ORF Vector (Rat) (pORF)

ORF079100 1.0 ug DNA
EUR 506.00

WDR61 ORF Vector (Human) (pORF)

ORF011566 1.0 ug DNA
EUR 95.00

Wdr61 ORF Vector (Mouse) (pORF)

ORF061787 1.0 ug DNA
EUR 506.00

Wdr61 ORF Vector (Mouse) (pORF)

ORF061788 1.0 ug DNA
EUR 506.00

Wdr61 ORF Vector (Mouse) (pORF)

ORF061789 1.0 ug DNA
EUR 506.00

Polyclonal WDR61 Antibody (N-Terminus)

APR03197G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WDR61 (N-Terminus). This antibody is tested and proven to work in the following applications:

WDR61 sgRNA CRISPR Lentivector set (Human)

K2633901 3 x 1.0 ug
EUR 339.00

Wdr61 sgRNA CRISPR Lentivector set (Mouse)

K3447301 3 x 1.0 ug
EUR 339.00

Wdr61 sgRNA CRISPR Lentivector set (Rat)

K7219201 3 x 1.0 ug
EUR 339.00

Polyclonal WDR61 Antibody - N-terminal region

APR01836G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WDR61 - N-terminal region. This antibody is tested and proven to work in the following applications:

WD Repeat-Containing Protein 61 (WDR61) Antibody

abx030183-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

WD Repeat-Containing Protein 61 (WDR61) Antibody

abx030183-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

WD Repeat-Containing Protein 61 (WDR61) Antibody

abx036337-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

WD Repeat-Containing Protein 61 (WDR61) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

WDR61 sgRNA CRISPR Lentivector (Human) (Target 1)

K2633902 1.0 ug DNA
EUR 154.00

WDR61 sgRNA CRISPR Lentivector (Human) (Target 2)

K2633903 1.0 ug DNA
EUR 154.00

WDR61 sgRNA CRISPR Lentivector (Human) (Target 3)

K2633904 1.0 ug DNA
EUR 154.00

Wdr61 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3447302 1.0 ug DNA
EUR 154.00

Wdr61 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3447303 1.0 ug DNA
EUR 154.00

Wdr61 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3447304 1.0 ug DNA
EUR 154.00

WD Repeat-Containing Protein 61 (WDR61) Antibody

abx239500-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

WD Repeat-Containing Protein 61 (WDR61) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

WDR61 Protein Vector (Mouse) (pPB-C-His)

PV247146 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPB-N-His)

PV247147 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPM-C-HA)

PV247148 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPM-C-His)

PV247149 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPB-C-His)

PV247150 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPB-N-His)

PV247151 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPM-C-HA)

PV247152 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPM-C-His)

PV247153 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPB-C-His)

PV247154 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPB-N-His)

PV247155 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPM-C-HA)

PV247156 500 ng
EUR 603.00

WDR61 Protein Vector (Mouse) (pPM-C-His)

PV247157 500 ng
EUR 603.00

Wdr61 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7219202 1.0 ug DNA
EUR 154.00

Wdr61 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7219203 1.0 ug DNA
EUR 154.00

Wdr61 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7219204 1.0 ug DNA
EUR 154.00

WDR61 Protein Vector (Human) (pPB-C-His)

PV046261 500 ng
EUR 329.00

WDR61 Protein Vector (Human) (pPB-N-His)

PV046262 500 ng
EUR 329.00

WDR61 Protein Vector (Human) (pPM-C-HA)

PV046263 500 ng
EUR 329.00

WDR61 Protein Vector (Human) (pPM-C-His)

PV046264 500 ng
EUR 329.00

Wdr61 3'UTR GFP Stable Cell Line

TU172247 1.0 ml Ask for price

WDR61 Protein Vector (Rat) (pPB-C-His)

PV316398 500 ng
EUR 603.00

WDR61 Protein Vector (Rat) (pPB-N-His)

PV316399 500 ng
EUR 603.00

WDR61 Protein Vector (Rat) (pPM-C-HA)

PV316400 500 ng
EUR 603.00

WDR61 Protein Vector (Rat) (pPM-C-His)

PV316401 500 ng
EUR 603.00

WDR61 3'UTR Luciferase Stable Cell Line

TU028434 1.0 ml
EUR 1394.00

WDR61 3'UTR GFP Stable Cell Line

TU078434 1.0 ml
EUR 1394.00

Wdr61 3'UTR Luciferase Stable Cell Line

TU122247 1.0 ml Ask for price

Wdr61 3'UTR Luciferase Stable Cell Line

TU223358 1.0 ml Ask for price

Wdr61 3'UTR GFP Stable Cell Line

TU273358 1.0 ml Ask for price

WD Repeat-Containing Protein 61 (WDR61) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

WD Repeat-Containing Protein 61 (WDR61) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

WD Repeat-Containing Protein 61 (WDR61) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

WDR61 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV660997 1.0 ug DNA
EUR 514.00

WDR61 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV661001 1.0 ug DNA
EUR 514.00

WDR61 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV661002 1.0 ug DNA
EUR 514.00

Pig WD repeat containing protein 61(WDR61) ELISA kit

E07W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig WD repeat containing protein 61(WDR61) ELISA kit

E07W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig WD repeat containing protein 61(WDR61) ELISA kit

E07W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog WD repeat containing protein 61(WDR61) ELISA kit

E08W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog WD repeat containing protein 61(WDR61) ELISA kit

E08W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog WD repeat containing protein 61(WDR61) ELISA kit

E08W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken WD repeat- containing protein 61, WDR61 ELISA KIT

ELI-22511c 96 Tests
EUR 928.00

Human WD repeat-containing protein 61 (WDR61) ELISA Kit

abx384299-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse WD repeat containing protein 61(WDR61) ELISA kit

E03W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse WD repeat containing protein 61(WDR61) ELISA kit

E03W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse WD repeat containing protein 61(WDR61) ELISA kit

E03W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit WD repeat containing protein 61(WDR61) ELISA kit

E04W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit WD repeat containing protein 61(WDR61) ELISA kit

E04W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit WD repeat containing protein 61(WDR61) ELISA kit

E04W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat WD repeat containing protein 61(WDR61) ELISA kit

E06W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat WD repeat containing protein 61(WDR61) ELISA kit

E06W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat WD repeat containing protein 61(WDR61) ELISA kit

E06W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat WD repeat containing protein 61(WDR61) ELISA kit

E02W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat WD repeat containing protein 61(WDR61) ELISA kit

E02W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat WD repeat containing protein 61(WDR61) ELISA kit

E02W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human WD repeat containing protein 61(WDR61) ELISA kit

E01W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human WD repeat containing protein 61(WDR61) ELISA kit

E01W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human WD repeat containing protein 61(WDR61) ELISA kit

E01W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey WD repeat containing protein 61(WDR61) ELISA kit

E09W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey WD repeat containing protein 61(WDR61) ELISA kit

E09W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey WD repeat containing protein 61(WDR61) ELISA kit

E09W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine WD repeat- containing protein 61, WDR61 ELISA KIT

ELI-44487b 96 Tests
EUR 928.00

Mouse WD repeat- containing protein 61, Wdr61 ELISA KIT

ELI-51079m 96 Tests
EUR 865.00

Human WD repeat- containing protein 61, WDR61 ELISA KIT

ELI-40562h 96 Tests
EUR 824.00

WDR61 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2633905 3 x 1.0 ug
EUR 376.00

Wdr61 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3447305 3 x 1.0 ug
EUR 376.00

Guinea pig WD repeat containing protein 61(WDR61) ELISA kit

E05W0011-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig WD repeat containing protein 61(WDR61) ELISA kit

E05W0011-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig WD repeat containing protein 61(WDR61) ELISA kit

E05W0011-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig WD repeat containing protein 61(WDR61) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Wdr61 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7219205 3 x 1.0 ug
EUR 376.00

WDR61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2633906 1.0 ug DNA
EUR 167.00

WDR61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2633907 1.0 ug DNA
EUR 167.00

WDR61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2633908 1.0 ug DNA
EUR 167.00

Wdr61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3447306 1.0 ug DNA
EUR 167.00

Wdr61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3447307 1.0 ug DNA
EUR 167.00

Wdr61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3447308 1.0 ug DNA
EUR 167.00

Wdr61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7219206 1.0 ug DNA
EUR 167.00

Wdr61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7219207 1.0 ug DNA
EUR 167.00

Wdr61 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7219208 1.0 ug DNA
EUR 167.00

WDR61 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV660998 1.0 ug DNA
EUR 514.00

WDR61 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV660999 1.0 ug DNA
EUR 572.00

WDR61 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV661000 1.0 ug DNA
EUR 572.00

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top