Tracking Neoantigens by Personalized Circulating Tumor DNA Sequencing during Checkpoint Blockade Immunotherapy in Non-Small Cell Lung Cancer.

Tracking Neoantigens by Personalized Circulating Tumor DNA Sequencing during Checkpoint Blockade Immunotherapy in Non-Small Cell Lung Cancer.

Neoantigens evolutionary dynamics related tumors carry information on drug sensitivity and resistance to immune checkpoint blockade (ICB). However, the spectrum of somatic mutations are very heterogeneous between patients, making it difficult to track neoantigens by circulating tumor DNA (ctDNA) sequencing using a “one size fits all” commercial gene panel. Thus, individually adjustable panel (ICPs) that is needed to track the evolution of a comprehensive neoantigen during treatment ICB. dominant neoantigens estimated from all data that exome sequencing on tumor tissue that has not been treated.

The panel predicted neoantigens targeting is used to personalize ctDNA sequencing. Analyzing the ten patients with lung cancer non-small cell ICPs dominant neoantigens effective to track the most predictable (80-100%) in a series of peripheral blood samples, and to detect substantially more genes (18-30) of the capacity of the current commercial gene this panel. A decline of more than 50% in the concentration ctDNA after eight weeks of administration ICB associated with progression-free survival benefit. Furthermore, at the individual level, the magnitude of the initial ctDNA response correlated with subsequent changes in tumor burden. CtDNA ICP-based application of sequencing are expected to improve the understanding of the evolution of ICB-driven tumor and to provide personal management strategies that optimize the clinical benefit of immunotherapy.

Tracking Neoantigens by Personalized Circulating Tumor DNA Sequencing during Checkpoint Blockade Immunotherapy in Non-Small Cell Lung Cancer.
Tracking Neoantigens by Personalized Circulating Tumor DNA Sequencing during Checkpoint Blockade Immunotherapy in Non-Small Cell Lung Cancer.

Identify locoregional gastric cancer patients at high risk for recurrence after resection can facilitate early intervention. By detecting the molecular residual disease (MRD), circulating tumor DNA (ctDNA) has been shown to predict postoperative recurrence in some cancers. Here, we aimed to evaluate the detection of MRD by ctDNA and its association with clinical outcomes in resected gastric cancer.

This prospective cohort study enrolled 46 patients with stage I-III gastric cancer who underwent resection with curative intent. Sixty resected tumor samples and 296 samples of plasma obtained for targeted sequencing within and extending ctDNA profiling. CtDNA detection correlated with clinicopathological features and postoperative disease-free (DFS) and overall survival (OS). ctDNA detected in 45% of plasma samples that have not been treated. As far as the primary tumor (T stage) were independently associated with preoperative positive ctDNA (p = 0.006)


YF-PA21726 50 ul
EUR 363
Description: Mouse polyclonal to WDR20


YF-PA21727 50 ug
EUR 363
Description: Mouse polyclonal to WDR20


YF-PA21728 100 ul
EUR 403
Description: Rabbit polyclonal to WDR20

WDR20 cloning plasmid

CSB-CL823451HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggcgacggagggaggagggaaggagatgaacgagattaagacccaattcaccacccgggaaggtctgtacaagctgctgccgcactcggagtacagccggcccaaccgggtgcccttcaactcgcagggatccaaccctgtccgcgtctccttcgtaaacctcaacgaccagtc
  • Show more
Description: A cloning plasmid for the WDR20 gene.

WDR20 cloning plasmid

CSB-CL823451HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1710
  • Sequence: atggcgacggagggaggagggaaggagatgaacgagattaagacccaattcaccacccgggaaggtctgtacaagctgctgccgcactcggagtacagccggcccaaccgggtgcccttcaactcgcagggatccaaccctgtccgcgtctccttcgtaaacctcaacgaccagt
  • Show more
Description: A cloning plasmid for the WDR20 gene.

anti- WDR20 antibody

FNab09486 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: WD repeat domain 20
  • Uniprot ID: Q8TBZ3
  • Gene ID: 91833
  • Research Area: Epigenetics
Description: Antibody raised against WDR20

Anti-WDR20 antibody

PAab09486 100 ug
EUR 412

Anti-WDR20 (2A6)

YF-MA11715 100 ug
EUR 363
Description: Mouse monoclonal to WDR20

Anti-WDR20 (1D10)

YF-MA19652 100 ug
EUR 363
Description: Mouse monoclonal to WDR20


EF004268 96 Tests
EUR 689

Mouse WDR20 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human WDR20 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WDR20 Recombinant Protein (Human)

RP034579 100 ug Ask for price

WDR20 Recombinant Protein (Human)

RP034582 100 ug Ask for price

WDR20 ORF Vector (Human) (pORF)

ORF011527 1.0 ug DNA
EUR 95

WDR20 ORF Vector (Human) (pORF)

ORF011528 1.0 ug DNA
EUR 95

WDR20 sgRNA CRISPR Lentivector set (Human)

K2629701 3 x 1.0 ug
EUR 339

WD Repeat-Containing Protein 20 (WDR20) Antibody

abx029810-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

WD Repeat-Containing Protein 20 (WDR20) Antibody

abx029810-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

WD Repeat-Containing Protein 20 (WDR20) Antibody

abx239486-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

WDR20 sgRNA CRISPR Lentivector (Human) (Target 1)

K2629702 1.0 ug DNA
EUR 154

WDR20 sgRNA CRISPR Lentivector (Human) (Target 2)

K2629703 1.0 ug DNA
EUR 154

WDR20 sgRNA CRISPR Lentivector (Human) (Target 3)

K2629704 1.0 ug DNA
EUR 154

WDR20 Protein Vector (Human) (pPB-C-His)

PV046105 500 ng
EUR 329

WDR20 Protein Vector (Human) (pPB-N-His)

PV046106 500 ng
EUR 329

WDR20 Protein Vector (Human) (pPM-C-HA)

PV046107 500 ng
EUR 329

WDR20 Protein Vector (Human) (pPM-C-His)

PV046108 500 ng
EUR 329

WDR20 Protein Vector (Human) (pPB-C-His)

PV046109 500 ng
EUR 329

WDR20 Protein Vector (Human) (pPB-N-His)

PV046110 500 ng
EUR 329

WDR20 Protein Vector (Human) (pPM-C-HA)

PV046111 500 ng
EUR 329

WDR20 Protein Vector (Human) (pPM-C-His)

PV046112 500 ng
EUR 329

WDR20 3'UTR GFP Stable Cell Line

TU078406 1.0 ml
EUR 1521

WDR20 3'UTR Luciferase Stable Cell Line

TU028406 1.0 ml
EUR 1521

WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV716763 1.0 ug DNA
EUR 316

WDR20 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV716767 1.0 ug DNA
EUR 316

WDR20 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV716768 1.0 ug DNA
EUR 316

Human WD repeat- containing protein 20, WDR20 ELISA KIT

ELI-16960h 96 Tests
EUR 824

Mouse WD repeat- containing protein 20, Wdr20 ELISA KIT

ELI-51469m 96 Tests
EUR 865

Human WD repeat-containing protein 20 (WDR20) ELISA Kit

abx384285-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2629705 3 x 1.0 ug
EUR 376

WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV716764 1.0 ug DNA
EUR 316

WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV716765 1.0 ug DNA
EUR 374

WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV716766 1.0 ug DNA
EUR 374

WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2629706 1.0 ug DNA
EUR 167

WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2629707 1.0 ug DNA
EUR 167

WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2629708 1.0 ug DNA
EUR 167

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top